I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

Clone ID: 24656

< back next >

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

clone ID: 24656
GB AccNum: T80278
GB GI: 698787
tigrID:
endedness: 5
Is Low Quality: 0
Is Reversed: 0
Seq Length: 129
Quality Seq Start: 1
Quality Seq Stop: 116
Longest Non Repeat: 0
GB Date Created: 1995-03-08 00:00:00
Sequence Modification Date: 2005-04-14 23:21:00
Is Active: 1
||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

seq:
ctgagttttcttcacccatggtcagggaagcgccatcncctggctttnaggctggggctcaggggaggttccggtanggg ctttgaagaggccgctgtttttgcaaggccgagacgcgggccctgcgca
masked seq:
CTGAGTTTTCTTCACCCATGGTCAGGGAAGCGCCATCNCCTGGCTTTNAGGCTGGGGCTCAGGGGAGGTTCCGGTANGGG CTTTGAAGAGGCCGCTGTTTTTGCAAGGCCGAGACGCGGGCCCTGCGCA
||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1688308
clone ID: 24656
row: h
column: 9
parent well ID:
plate ID: 4426
Plate Number: 76
plate geometry ID: 2
actual num clones: 380
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||

Problems

Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4426
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||

External Refs

Web page maintained by

Biological Questions and Comments to