Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Clone ID: 30220

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

< back    next >

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

clone ID: 30220
GB AccNum: R16324
GB GI: 769934
tigrID:
endedness: 5
Is Low Quality: 0
Is Reversed: 0
Seq Length: 311
Quality Seq Start: 1
Quality Seq Stop: 193
Longest Non Repeat: 0
GB Date Created: 1995-04-14 00:00:00
Sequence Modification Date: 2005-04-14 19:55:00
Is Active: 1
||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

seq:
gctgttgctgctgctgctggtgcantggagccgcgcgccgagttctacgccaaggtcgccctgtactgcgcgctgtgctt
cacggtgtccgccgtggcctcgctcgtctgcctgctgcgccacggcgctcggacggtggagaacatgagcatcatcggct
ggttcgtgcgaagtttcaagtacttttacgggctccgcttcgaggtncgggacccggcaggntgcaggangcccntccct
gtgtcattcgtctncaaccaccagagcatcctgnacatnatggntcctnattggaggtttcttncggancg

masked seq:
GCTGTTGCTGCTGCTGCTGGTGCANTGGAGCCGCGCGCCGAGTTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTT
CACGGTGTCCGCCGTGGCCTCGCTCGTCTGCCTGCTGCGCCACGGCGCTCGGACGGTGGAGAACATGAGCATCATCGGCT
GGTTCGTGCGAAGTTTCAAGTACTTTTACGGGCTCCGCTTCGAGGTNCGGGACCCGGCAGGNTGCAGGANGCCCNTCCCT
GTGTCATTCGTCTNCAACCACCAGAGCATCCTGNACATNATGGNTCCTNATTGGAGGTTTCTTNCGGANCG

||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1693871
clone ID: 30220
row: j
column: 17
parent well ID:
plate ID: 4439
Plate Number: 148
plate geometry ID: 2
actual num clones: 383
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||

Problems

Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4439
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||

External Refs


horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to