 |
I.M.A.G.E. Consortium
|
“Sharing resources to achieve a common goal — the discovery of all genes”
|
Clone ID: 35296
< back next >
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
clone ID: 35296
GB AccNum: R45241
GB GI: 823592
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 319
Quality Seq Start: 1
Quality Seq Stop: 282
Longest Non Repeat: 0
GB Date Created: 1995-05-22 00:00:00
Sequence Modification Date: 2005-04-14 21:00:00
Is Active: 1
||
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
seq:
cttttttnntttttttttttatatttcaagtgaatcatttaatgtgagtgaggctcagttaggtgttaccataagtatta
acagaagaaaaagggaaagcacaaacattttccctctaccagaaaagggtctgatgtaagataaactagcctgttggttt
aacaatagctcattaaaaaggccagagaatctgggnagaagatgtacttgggaagcactgtcctctgagggcccattccc
aagggacagcaaaatactgaaaaaaattaactgggctcaaaaattatattgagaggntaaaaagngttagttcacagct
masked seq:
CNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTGAATCATTTAATGTGAGTGAGGCTCAGTTAGGTGTTACCATAAGTATTA
ACAGAAGAAAAAGGGAAAGCACAAACATTTTCCCTCTACCAGAAAAGGGTCTGATGTAAGATAAACTAGCCTGTTGGTTT
AACAATAGCTCATTAAAAAGGCCAGAGAATCTGGGNAGAAGATGTACTTGGGAAGCACTGTCCTCTGAGGGCCCATTCCC
AAGGGACAGCAAAATACTGAAAAAAATTAACTGGGCTCAAAAATTATATTGAGAGGNTAAAAAGNGTTAGTTCACAGCT
||
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
Well ID: 1698939
clone ID: 35296
row: d
column: 9
parent well ID:
plate ID: 4398
Plate Number: 160
plate geometry ID: 2
actual num clones: 384
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||
Problems
Distributed Plates
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
plate ID: 4398
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||
External Refs
Web page maintained by
|
|
Biological Questions and Comments to
|